Non-verbal communication

I found it extremely difficult to communicate without speaking. I felt like I didn’t have a voice, and I felt very restricted.

The impression of the other person “holding” the conversation was that of frustration. They couldn’t really understand me and why I wasn’t reciprocating the conversation like they were. My actions made them feel like I was uninterested in the conversation.

The culture with the upper hand would most certainly be the “speaking” culture; they would have a way getting their complex ideas across because they would know how to formulate their words to convey a specific idea.  The speaking culture might look down upon the non-speaking culture because first off, their different, then their inability to verbally communicate the way the speaking culture is accustomed to.

Throughout there is one group that immediately comes to mind where referring to non-speaking communication. Deaf or those hard of hearing, people have a specific way of communicating without the use of words. They use sign language to communicate effectively. Often times I have noticed that when a person who is using their words to communicate tries to communicate with a person who cannot use words, they often speak louder in hopes that they can be heard by the person hard of hearing, which is definitely not the case and not necessary.

                                                             Speaking without gestures

         I definitely tried to last all of the 15 minutes without using my hand gestures or any body language at all. I really did not realize how difficult this exercise would be and what an intricate part of language hand gestures are. What made it difficult was that I didn’t feel like I was being as descriptive as I am used to.

This type of communication was very boring and mundane. The conversation was left to be very uninteresting and the other person did not seem like they were interested in what I had to say. Non-speech communication is extremely important to those that are hard of hearing. Their hands are their ears and without them they would most certainly have a harder time communication if at all.

I wouldn’t say that there are people who cannot read body language; however, what I would say is that there are people that misinterpret body language. If you are able to read body language effectively there would be little to no need for conversation in some cases. 

The boldest Fraud!!

              

The story of the Piltdown hoax goes, a laborer was digging in an area of the village Piltdown in Sussex in southern England, when he encountered a piece of bone. He showed to a local archaeologist, Charles Darwin; who then verified its antiquity and said that is was part of a human skull. Later he decided to search for the rest of the remains, and he come upon what looked like a jawbone. And about 3 years later, more pieces were found. All of these remains were thought to be “human-like” with an “ape-like” jawbone. The researchers thought they had finally found proof that apes evolved into humans. Almost forty years later in 1953 through the work of Dr. Kenneth Oakley the Piltdown find was said to be a hoax. He stated that the skull was that of a human and the jaw was from an orangutan. The teeth of the orangutan had been altered to make it look human.

As humans we would sometimes like to be the “first” at something. We are competitive in nature. So in the Piltdown Hoax it looks like the faults that came into play would be the desire to be first and the researchers wanted to truly believe that they were the founders and proved of the theory that humans derived from apes. However, it negatively impacted these findings because rather than carefully examining these finding the founder “jumped the gun” and immediately stated that and pushed the theory that humans derived from apes, and they supposedly had proof.

One of the positive aspects of this “unearthing” would be the use of fluorine testing. Flourine testing was used to determine the age of the fossils. This type of testing was founded by Kenneth Oakley in 1939. Subsequently, the Piltdown bones were tested in 1949 and were found to be much younger than previously thought.

I absolutely do not feel that the human factor should be taken out of science. That is how most of new discoveries are made, through trial and error. We as humans make plenty of mistakes, and it is those mistake that fuel us to find the right answers. The moral of the story in my opinion would be is always check and double-check. Never take someone’s discovery or what they as law. If it is in your power, research it on your own and come up with your own conclusions.

Comparative Primate Post

                         Comparative Primate Blog Post

                                                      Lemurs

 Lemurs are the oldest in the primate group. This species lives off the southern coast of Africa, on Madagascar. Lemurs migrated there from the continent of Africa to escape predators. They migrated on rafts they made of leaves and wood. Within this population of lemurs, the female lemur is dominant. Lemurs are nocturnal creatures who have adapted to the night and have been forced become so to escape their predators during the day. The smaller lemurs like to eat fruits and insects, while the larger lemurs are herbivores that would rather eat mostly plants.

Spider Monkeys

Spider monkeys are typically found in the tropical rainforests of Central and South America, from Mexico all the way down to Brazil. These monkeys have long tails and medium size legs which assist them in swing from trees where they spend their time. These monkeys are very sociable and love being around each other. Spider monkeys have a diet that consists of about 90% fruits and nuts. However they also eat leaves and small birds. Their tails are extremely long and have been referred to as their “third hand”, which helps them swing from trees with perfection. Additionally, they have no thumbs which also assist them in maneuvering throughout their habitat.  

                                                        Baboons

Baboons are indigenous to the continent of Africa, and in that continent there are 5 different species of baboon. Some of these species live the savanna; however some baboons prefer the tropical rainforests. In contrast to the spider monkeys, baboons do not swing from tress; they usually stay on the ground. Baboons eat fruits, grass, seeds, bark and also have a taste for some meats. They can eat birds and rodents, and will also eat a larger animal such as a sheep or antelope. Baboons also keep food in pouches on the sides of their mouth to store and eat later. 

                                               Gibbon Monkey

The Gibbons monkey is often referred to as the “acrobatic monkey”. They perfect the act of swinging from vine to vine and rarely descending to the ground. When they do descend to the ground they walk on their legs and hold their arms above their head to maintain balance. They thrive on eating fruit from the trees in the tropical environment they call home. They also eat bugs, insects and bird eggs. The gibbon’s monkey does not have a tail, unlike other monkeys in the rainforest, such as the spider monkey.  The fact that these monkeys stay high in the trees is so that they can stay away from predators on the forest floor that would cause them harm. Their arms are used for swinging and this helps them stay atop.

                                           Chimpanzee

Chimpanzees are classified as one of the Great Apes. They are largely found in the rainforest of Africa, specifically in the countries of Sudan, Tanzania and especially the republic of Congo, where the population is the largest. Chimpanzee’s have a bulky body and have hands that closely resemble that of a human, with digits that help them grasp objects very well.  These monkeys stay in the tress as well as the floor of the forest, however when they sleep they prefer within the tress to keep away from danger. These animals are mostly omnivores. They like to eat leaves and fruit; however they also like to eat berries and fruit and small animals on occasion. The chimpanzee is said to share 98% of humans DNA. This would probably explain their hands and the way they walk.

                                                            Summary

Within all the animals listed above, each has its own specific adaptation and traits specific to themselves. Such as the spider monkey, being the kind of habitat that it lives in calls for swinging through trees to stay away from predators, the tail comes in very handy. Also, the Lemur monkey is a nocturnal animal that is why its eyes are so large because they are used to see at night. Within all these animals is one specific behavior that is common and that is that they stay in packs and look out for each other. It also seems like they eat the same food, with variations here and there

Homologous and Analogous traits

                 

               Homologous and Analogous Traits

Homologous traits

a)      The Lizard and human arm similar in nature in the fact that the lizard has the bone structure of a human arm.

b

)      At the end of a human are there are 5 extensions which are called fingers. Also, at the end of a lizard’s leg are also five extensions, which closely resemble that of a human; the bone structure is the same. Each species have 6 bones on each limb. However the lizard uses his limbs in order to crawl and move fast. A human uses his limbs for other uses, such as opened doors, writing and dressing himself.

c)      I would say generally speaking the ancestors of species named above would be the dinosaurs and Neanderthals. The dinosaurs are the ancestors of lizards because of the body structure and survival tactics. Additionally the Neanderthals are ancestors of humans because again, of the same body structure, living techniques and facial features. 

Analogous traits

a)      Two different analogous species would be a butterfly and a bird wing. Although they are used for the same purpose, which is to fly they don’t immediately resemble each other.

b)      The function for both as stated earlier would be to fly. However, the wing of a butterfly is much smaller and more delicate than that of a bird wing. The limb of a butterfly is without bony structure and the wing of a bird had bony structure.

c)      I believe the common species of the butterfly and bird did posses analogous structure. That is what helped them fly in the first place. And both species have evolved from that.

                                

DNA Decoding

**DNA Decoding**

ACGCTACCAAGGGAGCGGAATTTCAAGTGTCTGGTGAAGGTTGTCTATCATTG