Homologous and Analogous traits

                 

               Homologous and Analogous Traits

Homologous traits

a)      The Lizard and human arm similar in nature in the fact that the lizard has the bone structure of a human arm.

b

)      At the end of a human are there are 5 extensions which are called fingers. Also, at the end of a lizard’s leg are also five extensions, which closely resemble that of a human; the bone structure is the same. Each species have 6 bones on each limb. However the lizard uses his limbs in order to crawl and move fast. A human uses his limbs for other uses, such as opened doors, writing and dressing himself.

c)      I would say generally speaking the ancestors of species named above would be the dinosaurs and Neanderthals. The dinosaurs are the ancestors of lizards because of the body structure and survival tactics. Additionally the Neanderthals are ancestors of humans because again, of the same body structure, living techniques and facial features. 

Analogous traits

a)      Two different analogous species would be a butterfly and a bird wing. Although they are used for the same purpose, which is to fly they don’t immediately resemble each other.

b)      The function for both as stated earlier would be to fly. However, the wing of a butterfly is much smaller and more delicate than that of a bird wing. The limb of a butterfly is without bony structure and the wing of a bird had bony structure.

c)      I believe the common species of the butterfly and bird did posses analogous structure. That is what helped them fly in the first place. And both species have evolved from that.

                                

DNA Decoding

**DNA Decoding**

ACGCTACCAAGGGAGCGGAATTTCAAGTGTCTGGTGAAGGTTGTCTATCATTG

Evolutionary Influences

     

                                         Influences on Charles Darwin

Charles Lyell (1797-1875)

          I believe the most influential individual for Charles Darwin would have to be Charles Lyell. Lyell was thought to believe and provide evidence that the earth is consistently changing. He also theorized the earth was much older than the previously thought; due to the visualized changes. Darwin eventually also believed that if the earth can be this old, why cant the organisms that inhabit the earth be just as old? Hence developing his theory of natural selection, due to the evolution process.

        Some of the most important contributions Lyell made to the scientific community were his help in aiding the belief that the earth was older the previously believed because of the changes with organisms throught the years, and beyond. Lyell who was a geologist, also believed that the fossil that were found in rocks were those of animals that lived before. Lyell and Darwin also both believed in uniformitarianism ,the belief that changes on the earths surface affect present day changes. However initially, Lyell did not believe in the theory of evolution until he read Origin of species, by Charles Darwin that Lyell began to adpot the idea the species infact do chnage over time rather than staying the same. Although the changes happen extremely slow and over many, many years. The key to figuring out the future changes is the look and the changes in the past. 

 http://www.infoplease.com/ce6/sci/A0850032.html#ixzz1xpzm0r4y

The statement that the resources on earth are limited is very true. I believe that the changes within the species are a direct correlation between resources available and the species mean in which to get them. The perfect saying that fits this example is" only the strong survive." If a species is noit able to adapt or survive in their environment, eventually they disappear; and make room for other species, which will hopefully mirror the previous species in many ways.

Darwin would have not been able to develop the Lyell theories alone because Darwin beliefs were somewhat different than Lyell's beliefs. Darwin wondered if he proves the theory of evolution within the environment, why wouldn't the same theory relate to the organisms in the environment as well? He wouldn't have made that argument if Lyell wouldn't have presented it to him, and made him question his own theories. 

    The attitude of the church had a major affect on Darwin and his publication the the book Origin of Species. At the time of publication the church already had their theory as to the earth and everything in it was created. Once the book came it questioned all the the church taught and pretty much turned the church believers' world upside down, because now they were at a loss as to what to believe in regards to creation and how things were and became.